ID: 1089496362_1089496383

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1089496362 1089496383
Species Human (GRCh38) Human (GRCh38)
Location 11:118910377-118910399 11:118910409-118910431
Sequence CCCCTCGTGCCCCACCCCCAGAG CGTGGAGGGGGCCCGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 604} {0: 1, 1: 0, 2: 1, 3: 24, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!