ID: 1089496663_1089496673

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1089496663 1089496673
Species Human (GRCh38) Human (GRCh38)
Location 11:118911495-118911517 11:118911517-118911539
Sequence CCCGCCACCCCCAGCTTCTCCAT TCACAACCAGGGAAGAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 99, 4: 626} {0: 1, 1: 0, 2: 1, 3: 33, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!