ID: 1089499902_1089499912

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089499902 1089499912
Species Human (GRCh38) Human (GRCh38)
Location 11:118925769-118925791 11:118925798-118925820
Sequence CCGGCCGGCTGGCTCCGGGCGGC GGTGCAGCGGCCCCGGGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 216} {0: 1, 1: 0, 2: 4, 3: 25, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!