ID: 1089515323_1089515329

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089515323 1089515329
Species Human (GRCh38) Human (GRCh38)
Location 11:119028371-119028393 11:119028412-119028434
Sequence CCCACTGACAAACTTGCTGATAG TGCTGGTGATGAACCCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 0, 2: 0, 3: 41, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!