|
Left Crispr |
Right Crispr |
Crispr ID |
1089516512 |
1089516518 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:119035724-119035746
|
11:119035750-119035772
|
Sequence |
CCTGTGGTCCCAGCTAATTGGGA |
TGAGGTGGCAGGATTGCTTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 28, 1: 4683, 2: 54889, 3: 172316, 4: 243730} |
{0: 13, 1: 943, 2: 2962, 3: 8299, 4: 19338} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|