ID: 1089516512_1089516518

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1089516512 1089516518
Species Human (GRCh38) Human (GRCh38)
Location 11:119035724-119035746 11:119035750-119035772
Sequence CCTGTGGTCCCAGCTAATTGGGA TGAGGTGGCAGGATTGCTTGAGG
Strand - +
Off-target summary {0: 28, 1: 4683, 2: 54889, 3: 172316, 4: 243730} {0: 13, 1: 943, 2: 2962, 3: 8299, 4: 19338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!