ID: 1089516513_1089516520

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1089516513 1089516520
Species Human (GRCh38) Human (GRCh38)
Location 11:119035732-119035754 11:119035758-119035780
Sequence CCCAGCTAATTGGGAGACTGAGG CAGGATTGCTTGAGGCAGGAAGG
Strand - +
Off-target summary {0: 23, 1: 4785, 2: 109370, 3: 225137, 4: 361355} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!