ID: 1089516513_1089516520 |
View in Genome Browser |
Spacer: 3 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1089516513 | 1089516520 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:119035732-119035754 | 11:119035758-119035780 |
Sequence | CCCAGCTAATTGGGAGACTGAGG | CAGGATTGCTTGAGGCAGGAAGG |
Strand | - | + |
Off-target summary | {0: 23, 1: 4785, 2: 109370, 3: 225137, 4: 361355} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |