ID: 1089524865_1089524867

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1089524865 1089524867
Species Human (GRCh38) Human (GRCh38)
Location 11:119090241-119090263 11:119090266-119090288
Sequence CCCGCATCTGGAGTTCAGGAGTA GTATCCTTTTAGAAGAGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125} {0: 1, 1: 0, 2: 4, 3: 44, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!