ID: 1089529457_1089529466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1089529457 1089529466
Species Human (GRCh38) Human (GRCh38)
Location 11:119116873-119116895 11:119116912-119116934
Sequence CCCTCCCCCTTTATTACCGTTTT CTCTGTGAGCAGTGGCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 205} {0: 1, 1: 0, 2: 0, 3: 40, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!