ID: 1089539158_1089539172

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1089539158 1089539172
Species Human (GRCh38) Human (GRCh38)
Location 11:119179675-119179697 11:119179728-119179750
Sequence CCCCTGCTTCTTTTTCAGGTGGT AAGCCGGGAGGCGGTGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 272} {0: 1, 1: 0, 2: 1, 3: 172, 4: 3349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!