ID: 1089555902_1089555904

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1089555902 1089555904
Species Human (GRCh38) Human (GRCh38)
Location 11:119315919-119315941 11:119315936-119315958
Sequence CCCTGTGAGGAGGTGATGTCACT GTCACTCGACACCATCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 159} {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!