ID: 1089560082_1089560095

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1089560082 1089560095
Species Human (GRCh38) Human (GRCh38)
Location 11:119339469-119339491 11:119339504-119339526
Sequence CCTCACCATGGCCCCCCCCGAGA TGGGCCACCCCCCGAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174} {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!