ID: 1089561533_1089561544

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1089561533 1089561544
Species Human (GRCh38) Human (GRCh38)
Location 11:119345739-119345761 11:119345762-119345784
Sequence CCCTTCTCCCGGAAGATCTGCCC CCAGTACTCACTGGACTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 147} {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!