ID: 1089602523_1089602532

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1089602523 1089602532
Species Human (GRCh38) Human (GRCh38)
Location 11:119624336-119624358 11:119624362-119624384
Sequence CCCAGGCAGCCGGCCTCTGCTCT CTCTAAACACAGCTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 315} {0: 1, 1: 0, 2: 3, 3: 29, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!