ID: 1089614485_1089614486

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1089614485 1089614486
Species Human (GRCh38) Human (GRCh38)
Location 11:119687510-119687532 11:119687526-119687548
Sequence CCAGCTGCAGCAAACAACACTGT ACACTGTCTTGTAGCAGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 217} {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!