ID: 1089620940_1089620952

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1089620940 1089620952
Species Human (GRCh38) Human (GRCh38)
Location 11:119721803-119721825 11:119721851-119721873
Sequence CCAGGACACTGCTTCCCTGGCCC CCTCTATTCTACACCAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 434} {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!