ID: 1089647886_1089647889

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1089647886 1089647889
Species Human (GRCh38) Human (GRCh38)
Location 11:119892145-119892167 11:119892167-119892189
Sequence CCTTGGGCTGCTTGGGCTTCTGG GGCTCTGATGTGCCTCCCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!