ID: 1089680545_1089680550

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1089680545 1089680550
Species Human (GRCh38) Human (GRCh38)
Location 11:120116775-120116797 11:120116798-120116820
Sequence CCTTGTGCAGCAGGCAGAAGTCC AGATAGAGAGTATGCTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 232} {0: 1, 1: 0, 2: 0, 3: 23, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!