ID: 1089696644_1089696655

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1089696644 1089696655
Species Human (GRCh38) Human (GRCh38)
Location 11:120219990-120220012 11:120220040-120220062
Sequence CCCCAGCTGTGCGACAGACCCCA GCTGCTCTTGAGCCAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 832} {0: 1, 1: 0, 2: 13, 3: 651, 4: 18102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!