ID: 1089700843_1089700848

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089700843 1089700848
Species Human (GRCh38) Human (GRCh38)
Location 11:120242903-120242925 11:120242932-120242954
Sequence CCAGCTAGGGAGGCAGATAAGAG GAAAACAGTGGGAAGCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168} {0: 1, 1: 0, 2: 4, 3: 22, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!