ID: 1089706702_1089706708

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089706702 1089706708
Species Human (GRCh38) Human (GRCh38)
Location 11:120283389-120283411 11:120283418-120283440
Sequence CCAGGATGTGGCAACCCAGCAGC TGGGCTGCCCCGTCCTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 174} {0: 1, 1: 0, 2: 1, 3: 22, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!