ID: 1089713780_1089713784

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1089713780 1089713784
Species Human (GRCh38) Human (GRCh38)
Location 11:120336673-120336695 11:120336691-120336713
Sequence CCTGGTGAGGGCGGCGAGCACAG CACAGAAGGAGCCCCGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 131} {0: 1, 1: 0, 2: 1, 3: 31, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!