ID: 1089732331_1089732343

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1089732331 1089732343
Species Human (GRCh38) Human (GRCh38)
Location 11:120527110-120527132 11:120527154-120527176
Sequence CCAGCACCCAGTCCTGGGGAACC GGGTTGCCCTGATCCCGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 375} {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!