ID: 1089733686_1089733691

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1089733686 1089733691
Species Human (GRCh38) Human (GRCh38)
Location 11:120535251-120535273 11:120535264-120535286
Sequence CCAGGGAAGAACCTCCTGGGACC TCCTGGGACCAGAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 192} {0: 1, 1: 0, 2: 7, 3: 48, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!