ID: 1089736077_1089736089

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1089736077 1089736089
Species Human (GRCh38) Human (GRCh38)
Location 11:120551032-120551054 11:120551083-120551105
Sequence CCAGAATGAAGGCCTTGAGAAGG GTTTGGCCTCTTATGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 183} {0: 1, 1: 0, 2: 1, 3: 12, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!