ID: 1089748328_1089748334

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1089748328 1089748334
Species Human (GRCh38) Human (GRCh38)
Location 11:120632587-120632609 11:120632627-120632649
Sequence CCAGCCACCTTCTTCCTGCTCTT GCTGAAAACTTGGCTCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 91, 4: 844} {0: 1, 1: 0, 2: 4, 3: 62, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!