|
Left Crispr |
Right Crispr |
| Crispr ID |
1089761763 |
1089761764 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:120731608-120731630
|
11:120731639-120731661
|
| Sequence |
CCTGTTTTTTGGAATAGTTTGAG |
GTATTAGTTCTTTAAATGTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 13, 2: 51, 3: 190, 4: 473} |
{0: 115, 1: 267, 2: 350, 3: 498, 4: 1644} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|