ID: 1089762736_1089762744

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1089762736 1089762744
Species Human (GRCh38) Human (GRCh38)
Location 11:120740336-120740358 11:120740373-120740395
Sequence CCAGCCTTTTGCGGTGGCAGTAG TTCCCTCACCCCCGCATGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80} {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!