ID: 1089771933_1089771939

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1089771933 1089771939
Species Human (GRCh38) Human (GRCh38)
Location 11:120809189-120809211 11:120809238-120809260
Sequence CCTGGGCTTCTAAGGGGTCTCCA GATGAAGAAGTCCCTCCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 165} {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!