ID: 1089773750_1089773760

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1089773750 1089773760
Species Human (GRCh38) Human (GRCh38)
Location 11:120821581-120821603 11:120821634-120821656
Sequence CCTTGTGGAACAACTGGTTTTGG TGGAATTAGACCCAAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 172} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!