ID: 1089775913_1089775916

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089775913 1089775916
Species Human (GRCh38) Human (GRCh38)
Location 11:120835674-120835696 11:120835703-120835725
Sequence CCAGTGGCCCAGGGCTGCAGAAT TGAAAATCTAGCCGACTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 235} {0: 1, 1: 0, 2: 1, 3: 1, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!