ID: 1089781426_1089781438

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089781426 1089781438
Species Human (GRCh38) Human (GRCh38)
Location 11:120875687-120875709 11:120875728-120875750
Sequence CCACCCCCATGCCAATGACACAG CCTGCCTGCTCCATCATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 269} {0: 1, 1: 0, 2: 1, 3: 19, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!