ID: 1089787426_1089787431

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089787426 1089787431
Species Human (GRCh38) Human (GRCh38)
Location 11:120918057-120918079 11:120918072-120918094
Sequence CCCAGCCACACAGCAGAGATGAG GAGATGAGGATGTTACCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 316} {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!