ID: 1089800695_1089800709

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1089800695 1089800709
Species Human (GRCh38) Human (GRCh38)
Location 11:121024428-121024450 11:121024464-121024486
Sequence CCTGTCTCGAGCAGCTGTGGGGA CTGGGGCTAGAGGGAGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 1, 2: 9, 3: 89, 4: 674}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!