ID: 1089809524_1089809535

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1089809524 1089809535
Species Human (GRCh38) Human (GRCh38)
Location 11:121120442-121120464 11:121120469-121120491
Sequence CCCGACCCAGGGTGATGTGGGGA CAGGGAGAGGGCTGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 268} {0: 1, 1: 1, 2: 15, 3: 131, 4: 1082}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!