ID: 1089809524_1089809538

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1089809524 1089809538
Species Human (GRCh38) Human (GRCh38)
Location 11:121120442-121120464 11:121120489-121120511
Sequence CCCGACCCAGGGTGATGTGGGGA AGGAAGGAGCCTGAGATGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 268} {0: 1, 1: 1, 2: 6, 3: 40, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!