ID: 1089834432_1089834441

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1089834432 1089834441
Species Human (GRCh38) Human (GRCh38)
Location 11:121357615-121357637 11:121357637-121357659
Sequence CCTGAGAAGGAAGGAGATGAACC CAGGTGGTCGGGAGGGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!