ID: 1089855141_1089855145

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1089855141 1089855145
Species Human (GRCh38) Human (GRCh38)
Location 11:121537060-121537082 11:121537083-121537105
Sequence CCAGGTCTAGAGAGACCTTGAGC AAGGGCCAAAGCATGATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 2, 3: 25, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!