ID: 1089908351_1089908355

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1089908351 1089908355
Species Human (GRCh38) Human (GRCh38)
Location 11:122069350-122069372 11:122069369-122069391
Sequence CCACTGGATACAGCCATTGTAAG TAAGAGTTGAATAATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!