ID: 1089944434_1089944443

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1089944434 1089944443
Species Human (GRCh38) Human (GRCh38)
Location 11:122453705-122453727 11:122453746-122453768
Sequence CCTCTTCCCAGACCTGGGCATCA AAGAGGAAACATAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 60, 4: 317} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!