ID: 1089971472_1089971480

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1089971472 1089971480
Species Human (GRCh38) Human (GRCh38)
Location 11:122696913-122696935 11:122696961-122696983
Sequence CCCTGTGCTAGCTGTTAAAATAG CAAGTAAAGATCAGGCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172} {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!