ID: 1089979701_1089979707

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1089979701 1089979707
Species Human (GRCh38) Human (GRCh38)
Location 11:122762176-122762198 11:122762192-122762214
Sequence CCGTGCCCCTGGCTTGCTGTTGT CTGTTGTCCTTGGGTAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 34, 4: 390} {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!