ID: 1090012512_1090012517

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1090012512 1090012517
Species Human (GRCh38) Human (GRCh38)
Location 11:123057828-123057850 11:123057841-123057863
Sequence CCTCCTGCACTCTGGTACAGCTT GGTACAGCTTGGTGATGATGGGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 2, 3: 22, 4: 200} {0: 2, 1: 4, 2: 1, 3: 10, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!