ID: 1090074480_1090074486

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1090074480 1090074486
Species Human (GRCh38) Human (GRCh38)
Location 11:123571410-123571432 11:123571449-123571471
Sequence CCTCATCCTCTTTTTCTACTTCC CAGCTAGACCTAACTATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 241, 4: 2009} {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!