ID: 1090086301_1090086306

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1090086301 1090086306
Species Human (GRCh38) Human (GRCh38)
Location 11:123654042-123654064 11:123654058-123654080
Sequence CCGCTCCGCGCCCGCTCTCGCCG CTCGCCGGCGCTCAGCACCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 251} {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!