ID: 1090091731_1090091740

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1090091731 1090091740
Species Human (GRCh38) Human (GRCh38)
Location 11:123703984-123704006 11:123704010-123704032
Sequence CCCTTTGAGCCCCTAGAACAGGG TCCAAACTTTTGGCTTCCCTGGG
Strand - +
Off-target summary No data {0: 25, 1: 800, 2: 1024, 3: 615, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!