ID: 1090091731_1090091746

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1090091731 1090091746
Species Human (GRCh38) Human (GRCh38)
Location 11:123703984-123704006 11:123704036-123704058
Sequence CCCTTTGAGCCCCTAGAACAGGG CATTGGAAGAAGAATTGTCTTGG
Strand - +
Off-target summary No data {0: 215, 1: 433, 2: 341, 3: 249, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!