ID: 1090091733_1090091739

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090091733 1090091739
Species Human (GRCh38) Human (GRCh38)
Location 11:123703985-123704007 11:123704009-123704031
Sequence CCTTTGAGCCCCTAGAACAGGGG GTCCAAACTTTTGGCTTCCCTGG
Strand - +
Off-target summary No data {0: 22, 1: 750, 2: 1031, 3: 687, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!