ID: 1090091733_1090091742

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1090091733 1090091742
Species Human (GRCh38) Human (GRCh38)
Location 11:123703985-123704007 11:123704019-123704041
Sequence CCTTTGAGCCCCTAGAACAGGGG TTGGCTTCCCTGGGCCACATTGG
Strand - +
Off-target summary No data {0: 419, 1: 887, 2: 867, 3: 500, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!