ID: 1090130943_1090130951

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090130943 1090130951
Species Human (GRCh38) Human (GRCh38)
Location 11:124141623-124141645 11:124141650-124141672
Sequence CCGTCCTCCTTCTGCATCTCAGC AGGGGAACTTATGTGTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 614} {0: 1, 1: 0, 2: 1, 3: 13, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!