ID: 1090137057_1090137074

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1090137057 1090137074
Species Human (GRCh38) Human (GRCh38)
Location 11:124209812-124209834 11:124209863-124209885
Sequence CCCGCCACCTTCTGCCCAGGAGC GCTACAACAATGCCCGGGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!